WWW.DISSERTATION.XLIBX.INFO
FREE ELECTRONIC LIBRARY - Dissertations, online materials
 
<< HOME
CONTACTS



Pages:   || 2 |

«Investigating Bear and Panda Ancestry Adapted from Maier, C.A. (2001) “Building Phylogenetic Trees from DNA Sequence Data: Investigating Polar Bear ...»

-- [ Page 1 ] --

Investigating Bear and Panda Ancestry

Adapted from Maier, C.A. (2001) “Building Phylogenetic Trees from DNA Sequence Data: Investigating

Polar Bear & Giant Panda Ancestry.” The American Biology Teacher. 63:9, Pages 642-646.

We have already used some molecular databases to examine evolutionary relationships among reptiles,

bats, and birds, as well as conducting our own studies of evolutionary relationships. We have used

amino acid sequences for proteins to examine these questions. We will now go “one level deeper” as we explore DNA sequences and how these can also be used to create evolutionary relationships.

You might wonder, “how do I decide if to use protein or DNA sequence data, and for which sequences?” The answer is to use as many resources as you have. You may not obtain the SAME result when using different resources. That is, a phylogenetic tree based on hemoglobin amino acids may not look the same as a tree based on DNA encoding rRNA. Likewise, trees based on morphology may not agree with molecular based trees. But scientists look at all these data, and draw conclusions based on overlaps and consistent patterns between the various data sources.

For this exercise you will investigate these questions: 1) “What is the relationship between the polar bear and the American Brown bear?” The geographic ranges of these two species are in close proximity. Did the polar bear evolve from a population of American brown bear that were isolated far north (allopatric speciation)? 2) How about the giant panda? This species superficially resembles the bear family and yet its diet, behavior, and genital structure are quite different (Morris and Morris, 1981). 3) Finally, red pandas may not be named appropriately. Although facial features look “panda-ish,” the life history is not that much like a panda and the tail certainly isn’t bear-ish. Is the giant panda a bear or did it branch from some other lineage? We will address these questions by building genetic distance matrices and phylogenetic trees based on molecular sequence data.

It is possible to create a molecular phylogenetic tree of the panda and bear families because the 12s ribosomal RNA gene sequences from several bear species and the giant panda are available from GenBank (a molecular database). Since the 12s ribosome gene is carried on the mitochondrial chromosome, it does not undergo recombination and is inherited directly from mother to offspring through the egg. These characteristics make mitochondrial genes excellent tools for studying the family trees of closely related species (Cann et al, 1987).

You will be performing two sets of analyses. First, you will look at several bear species and examine their DNA (and therefore evolutionary relationships). Next, you will include the giant panda and determine its relationship to other bear species. From your findings, we will discuss whether the data support the giant panda and red panda being classified among the bears, or whether they belong in separate groups.

Procedure:

These are the steps to access bear and giant panda 12s rRNA sequence from GenBank, import them into Biology workbench, then use Biology Workbench nucleic acid tools to align chosen sequences, create genetic distance matrices, and develop phylogenetic trees. Because you have experience searching for sequences by name, we have provided you with accession numbers to make things go faster (see table on the top of page 2).

1. Access the 12s rRNA sequences and import them into sequence analysis software. Go to www.ncbi.nlm.nih.gov. Select “Nucleotide”, enter the accession number for the following 12s rRNA gene sequences one at a time, and select “GO.”

–  –  –

2. Click on the accession number.

3. Next to the “Display” window, select “FASTA” to bring up the gene sequence in FASTA format.

4. Highlight and copy the entire FASTA sequence, up to and including the initial “” symbol.

Paste into a WORD document.

5. Repeat steps 2-4, finding, displaying, highlighting, copying and pasting until all 12s rRNA sequences have been found.

6. SAVE your WORD document!!!

7. From the WORD menu, under FILE, select SAVE AS. In the resulting window, look for the format option, then select TEXT ONLY (the default is a formatted WORD document with hidden codes), then click on SAVE. This step saves your sequences as a simple text file, which is preferred by most bioinformatics application. The hidden formatting commands in WORD often cause errors in sequence analysis. You should now have two copies if your 12s rRNA sequences; one as a word document (file name ends in.doc, such as bears.doc) and one as a text document (file name ends in.txt, such as bears.txt).

7. Go to Biology Workbench. http://workbench.sdsc.edu (Notice: NO www)

8. Select “Session” then “Start New Session,”

9. Name the session then select Start

10. Select “Nucleic Tools”

11. Select “Add New Nucleic Sequence” then click on “RUN”

12. In the Label box, name the session then click on RUN

13. Now you could toggle back and forth from NCBI to WORKBENCH and copy and paste FASTA sequences but you saved them all in a WORD document, so let’s explore another way to add sequences to WORKBENCH. Click on “Browse” and find your TEXT document (bears.txt), select it, then select “Upload File.” Just like magic, your sequences will all end up in separate windows. IF they don’t, you have probably selected the bears.doc instead of bears.txt.





14. Edit the FASTA label in the “Sequence” box (the box containing all the A, T, C, and G). Leave the but delete all but the name of the critter – in other words the names you want to appear on the tree.

15. Select “SAVE.” Now you have a session with a bunch of sequences, all individually listed. You can select two or more as you need them.

Align the Bear 12s rRNA Gene Sequences.

1. For now, select all the bears but omit the raccoon, dog, and skink.

2. Choose CLUSTALW then “RUN” then “SUBMIT”.

3. Copy and Paste the Phylogram into a WORD Document. This is data you will be turning in.

4. Click on “IMPORT ALIGNMENT” to enter the Alignment Tools section of the Biology Workbench.

2Determine the Genetic Distance between sequence pairs.

1. Click on the box to the left of the imported and aligned sequences, then choose “CLUSTALDIST,” “Run”, and “SUBMIT.” Print the distance matrix so that you can examine it closely later.

2. Copy and paste the “Clustal Distance Matrix” table into a WORD document. This is also data!! You will examine it and turn it in.

3. The last piece of data that could be helpful in the future (so you should include) is a BOXSHADE.

You can also copy and paste this into a WORD document.

Repeat the alignment, phylogram, and matrix after including the dog and raccoon, then again after adding the cow and the skink.

Analysis Questions. Answer these questions after analyzing the data you obtained from alignments, matrices, and phylograms..

1. What are we trying to show by constructing phylograms, matrices and sequence alignments?

2. As you examine the phylogenetic tree of the bear species’ 12s rRNA gene sequences, which two are most closely alike? Which “pair of bears” seems to be the most distantly related?

3. Which are closer relatives; “American Brown and American Black Bears” or “American Black and Asiatic Black Bears”? Explain your answer referring to your data.

4. Is the giant panda more of an “American” relative or “Asiatic” relative as compared to the bear group? Explain.

5. Further research the spectacled bear. Where is it found today? Explain its possible evolutionary origin.

6. Does the Giant Panda “belong” in the bear family at all? Explain your answer.

7. Where does the Red Panda fit into the phylogenetic tree? Who are its closest relatives?

8. Why did we include a cow and a crocodile skink in the final phylogram? What other organisms could have served the same purpose?

9. Finally, if you were a taxonomist, how would you answer this question: What is a bear? Is a bear a dog or is a dog a bear?

Include with your answers, your data, phylograms and any outside research that you used to answer these questions.

3

TEACHERS GUIDE

Examining Phylogeny of Bears using Biology Workbench.

Sequences Used to prepare this key.

American Black-gi|1871572|emb|Y08520.1|MIUA12SR U.americanus mitochondrial 12S rRNA gene

CAAAGGTTTGGTCCTGGCCTTCCTATTAGCTGCTAACAAGATTACACATGTAAGTCTCCGCGCCCCAGTG

AAAATGCCCTTTGGATCTTAAAGCGGTTCGAAGGAGCGGGCATCAAGCACACCTCTCCCCGGTAGCTTAT

AACGCCTTGCTTAGCCACACCCCCACGGGATACAGCAGTGATAAAAATTAAGCTATGAACGAAAGTTTGA

CTAAGCTATGTTGATCAAAGGGTTGGTTAATTTCGTGCCAGCCACCGCGGTTATACGATTGACCCAAGTT

AATAGGCCCACGGCGTAAAGCGTGTGAAAGAAAAATTTTTTCCCCACTAAAGTTAAAGTTTAACCAAGCT

GTAAAAAGCTATCGGTAACACTAAAATAAACTACGAAAGTGACTTTAATACTCTCAACCACACGACAGCT

AAGATCCAAACTGGGATTAGATACCCCACTATGCTTAGCCTTAAACATAAGTAATTTATTAAACAAAATT

ATTCGCCGGAGAACTACTAGCAACAGCTTAAAACTCAAAGGACTTGGCGGTGCTTTAAACCCCCCTAGAG

GAGCCTGTTCTATAATCGATAAACCCCGATAGACCTCACCACCTCTTGCTAATCCAGTCTATATACCGCC

ATCTTCAGCTAACCCTTAAAAGGAGTAAAAGTAAGCACAATCATCCCACATAAAAAAGTTAGGTCAAGGT

GTAACCCATGGGGTGGGAAGAAATGGGCTACATTTTCTATTCAAGAACAACCTACGAAAGTTTTTATGAA

ACTAAAAACTAAAGGTGGATTTAGCAGTAAACCAAGAATAGAGAGCTTGGTTGAATAGGGCAATGGAGCA

TGCACACACCGCCCGTCACCCTCCTCAAGTGGCACAAGTCAAATATAACCTATTGAAATTAAATAAAACG

CAAGAGGAGACAAGTCGTAACAAGGTAAGCATACTGGAAAGTGTGCTTGGATAAAC

American Brown Bear gi|418058|gb|L21889.1|URSMTRG12S Ursus arctos mitochondrial 12S ribosomal RNA (12S rRNA) gene fragment

AAATAATTCATTAAACAAAATTATTCACCAGAGAACTACTAGCAACAGCTTAAAACTCAAAGGACTTGGC

GGTGCTTTAAACCCTCCTAGAGGAGCCTGTTCTATAATCGATAAACCCCGATAGACCTCACCACCTCTTG

CTAATTCAGTCTATATACCGCCATCTTCAGCAAACCCTTAAAAGGAACAAGAGTAAGCACAATCATCTTG

CATAAAAAAGTTAGGTCAAGGTGTAACCCATGGGGTGGGAAGAAATGGGCTACATTTTCTATTCAAGAAC

AACTTACGAAAGTTTTTATGAAACTAAAAACTAAAGGTGGATTTAGTAGTAAATCAAGAATAGAGAG

Spectacled Bear gi|418052|gb|L21883.1|TMCMTRG12S Tremarctos ornatus mitochondrial 12S ribosomal RNA (12S rRNA) gene fragment

AGATAATTTACCAAACAAAATTATTCGCCAGAGAACTACTAGCAATCGCTTAAAACTCAAAGGACTTGGC

GGTGCTTTAAACCCCCTAGAGGAGCCTGTTCTATAACCGATAAACCCCGATAAACCTCACCACCCCTTGC

TAATCCAGTCTATATACCGCCATCTTCAGCGAACCCTTAAAAGGAAAAAAAGTAAGCATAATTATCTCAC

ATAAAAAAGTTAGGTCAAGGTGTAACCTATGGGATGGGAAGAAATGGGCTACATTTTCTACTCAAGAATA

GTCTACGAAAATTTTTATGAAACTAAAAACTAAAGGCGGATTTAGTAGTAAACTAAGAATAGAGAG

Asiatic black bear gi|418045|gb|L21890.1|SNAMTRG12S Selenarctos thibetanus mitochondrial 12S ribosomal RNA (12S rRNA) gene fragment

AAATAATTTATCAAACAAAATTATTCGCCAGAGAACTACTAGCAACGGCTTAAAACTCAAAGGACTTGGC

GGTGCTTTAAACCCCCCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATAGACCTCACCACCCCTTG

CTAATCCAGTCTATATACCGCCATCTTCAGCGAACCCTTAAAAGGAAAAAGAGTAAGCACAATCATCTTG

CATAAAAAAGTTAGGTCAAGGTGTAACCCATGGGATGGGAAGAAATGGGCTACATTTTCTATTCAAGAAC

AACCTACGAAAGTTTTTATGAAACTAAAAACTAAAGGTGGATTTAGTAGTAAACCAAGAATAGAGAG

Polar bear gi|418048|gb|L22164.1|TLTMTRG1SA Thalarctos maritimus mitochondrial 12S ribosomal

RNA gene fragment AGATAATTTACCAAACAAAATTATTCGCCAGAGAACTACTAGCAACCGCTTAAAACTCAAAGGACTTGGC

GGTGCTTTAAACCCCCTAGAGGAGCCTGTTCTATAACCGATAAACCCCGATAAACCTCACCACCCCTTGC

TAATCCAGTCTATATACCGCCATCTTCAGCGAACCCTTAAAAGGAAAAAAAGTTAGCATAATTATCTCAC

ATAAAAAAGTTAGGTCAAGGTGTAACCTATGGGATGGGAAGAAATGGGCTACATTTTCTACTCAAGAACA

GTCTACGAAAATTTTTATGAAACTAAAAACTAAAGGTGGATTTAGTAGTAAACTAAGAATAGAGAG

Giant Panda gi|1871553|emb|Y08521.1|MIAM12SR A.melanoleuca mitochondrial 12S rRNA gene

TAAAGGTTTGGTCCTAGCCTTCCTATTAGCCATTAACAAGATTACACATGTAAGTCTCCACGCTCCAGTG

AAAATGCCCCTTAAGTCCTCTTAGACGACCTAAAGGAGCGGGTATCAAGCACACCTTATGGTAGCTCACA

ACGCCTTGCTTAGCCACACCCCCACGGGAAACAGCAGTGATAAAAATTAAGCTATGAACGAAAGTTCGAC

TAAGCTATGTTAATACTAGGGTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAACTCGAGTTA

ATAGGCCTACGGCGTAAAGCGTGTAAAAGAAAAAATCTCCTCTACTAAAGTTAAAGTATGATTAAGCTGT

AAAAAGCTACCATTAATACTAAAATAAACTACGAAAGTGACTTTAAAATTTCTGATTACACGATAGCTAG

GGCCCAAACTGGGATTAGATACCCCACTATGCCTAGCTCTAAACATAGATATTTTACTAAACAAAACTAT

TCGCCAGAGAACTACTAGCAACAGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATATCCCCCTAGAGGA

GCCTGTTCTGTAATCGATAAACCCCGATAGACCTCACCATCCCTTGCTAATTCAGTTTATATACCGCCAT

CTTCAGCAAACCCTTAAAAGGAAAAAAAGTAAGCATAACTACCCTACATAAAAAAGTTAGGTCAAGGTGT

AACCTATGGGCTGGGAAGAAATGGGCTACATTTTCTATTCAAGAACAACTTCTACGAAAACTTTTATGAA

ACTAAAAGCTAAAGGCGGATTTAGTAGTAAATTAAGAATAGAGAGCTTAATTGAACAGGGCAATGAAGCA

CGCACACACCGCCCGTCACCCTCCTCGAGTGATATAATTTAATTATAACCTATTTAAACTAAGCAAAGCA

TAAGAGGAGACAAGTCGTAACAAGGTAAGCATACTGGAAAGTGTGCTTGGATGAGC

Red Panda gi|1911545|gb|S80939.1| 12S rRNA [Ailurus fulgens=red pandas, Mitochondrial, 349

nt] AAAACTATTCGCCAGAGAACTACTAGCAATAGCCTAAAACTCAAAGGACTTGGCGGTGCTTTACACCCCT

CTAGAGGAGCCTGTTCTATAATCGATAAACCCCGATAAACCTTACCACTTCTAGCTACTTCAGTCTATAT



Pages:   || 2 |


Similar works:

«New York State Testing Program ELA Common Core Sample Questions 3 Grade The materials contained herein are intended for use by New York State teachers. Permission is hereby granted to teachers and nonprofit organizations or institutions to reproduce these materials for their own use, but not for sale, provided copyright notices are retained as they appear in this publication. This permission does not apply to mass distribution of these materials, electronically or otherwise. Grade 3 ELA 1...»

«Teachers College, Columbia University Working Papers in TESOL & Applied Linguistics, 2008, Vol. 8, No. 2 The Forum A Multi-Layered Framework of Framing Rebekah J. Johnson Teachers College, Columbia University Professor Leslie M. Beebe has always been an unfailing source of encouragement, a wealth of knowledge and insight, and a wonderful critic. She has taught me much about pragmatics and sociolinguistics, the foundations of my current interests in the social construction of meaning in...»

«The Privilege of Teaching I would like to begin by firstly clarifying that it is my most esteemed and heartfelt privilege to be a teacher. It is an honour to be entrusted with this distinct task of being part of educating the future generations of Canadian children to help them reach their full potential and open up new avenues and universes for them to explore. As a parent I know full well that I entrust my most precious treasure to others for the majority of their waking day and gladly and...»

«THE INFLUENCE OF CONTEXTUAL FACTORS ON REVISION STRATEGIES: THE CASE OF FOUR MALAYSIAN NATIVE SPEAKERS OF ENGLISH IN A MAINSTREAM E.S.L. CLASSROOM Vijay Kumar Mallan A thesis submitted for the degree of Doctor of Philosophy at the University of Otago, Dunedin, New Zealand July 2005 Dedicated to Margaret, Vinoth and Vinesh i ABSTRACT This case study explored the revision strategies of four Malaysian native speakers of English when they composed aloud while writing an argumentative essay. Think...»

«Margaret R. Basom & Diane M. Yerkes Educational Leadership and Administration A School-University Partnership in Administrator Preparation: Learnings and Subsequent Questions Margaret R. Basom San Diego State University & Diane M. Yerkes University of San Diego Abstract: School university partnerships have become important in the reform efforts to develop the next generation of school leaders. This study examines one university’s approach of working with several school districts as partners...»

«TMME, vol7, nos.2&3, p.295 Vectors in Climbing Anne Birgitte Fyhn1 University of Tromsø, Norway Abstract: In this article, the work on mesospace embodiments of mathematics is further developed by exploring the teaching and learning of vector concepts through climbing activities. The relevance and connection between climbing and vector algebra notions is illustrated via embedded digital videos. Keywords: climbing and mathematics; digital media; egocentric vs allocentric representations;...»

«Introduction: The Transformative Work of Michael A. Signer FRANKLIN T. HARKINS The essays collected in this volume are dedicated to Michael A. Signer by a select group of his colleagues, students, and friends. Their collective purpose is to honor him, on the occasion of his thirty-fifth anniversary of teaching, as a scholar and teacher of Judaism, Christianity, and Jewish-Christian relations in antiquity, the Middle Ages, and modernity. As Professor of Jewish History at Hebrew Union College –...»

«OECD Innovative Learning Environment Project Universe Case Austria Goethe-Gymnasium This academic secondary school uses different self-developed forms of assessment to document student progress and to monitor educational quality, including cooperation with a school in St. Petersburg for external evaluation, (repeated) screenings of the students’ reading skills, repeated questionnaires for first-year students to document their transfer from primary to secondary school, and surveys for...»

«WORKSHOP DESCRIPTIONS Story Circles—Personal Mandala Creation and Exploration In this workshop, Cassia will guide you through creating your own sacred circular art piece. This mandala exploration blends art making and sacred geometry in a stunning way allowing you to identify and process personal stories through creative expression. Art meets mindfulness as pen meets paper. Creative Exploring on Canvas Explore the 4 key concepts, creativity, community, collaboration, connection through...»

«Ana min al yahud I'm one of the Jews By Almog Behar 1. At that time, my tongue twisted around and with the arrival of the month of Tammuz the Arabic accent got stuck in my mouth, deep down in my throat. Just like that, as I was walking down the street, the Arabic accent of Grandfather Anwar of blessed memory came back to me and no matter how hard I tried to extricate it from myself and throw it away in one of the public trash cans I could not do it. I tried and tried to soften the glottal...»

«DOCUMENT RESUME ED 271 538 UD 024 997 AUTHOR Connelly, F. Michael; Clandinin, D. Jean The Role of Teachers' Personal Practical Knowledge in TITLE Effecting Board Policy. Volume IV: Teachers' Personal Practical Knowledge and Race Relations. Ontario Inst. for Studies in Education, Toronto.INSTITUTION SPONS AGENCY National Inst. of Education (ED), Washington, DC.; Social Sciences and Humanities Research Council of Canada, Ottawa (Ontario). PUB DATE 84 410-80-0688-K1; NIE-G-81-0021 GRANT 62p.; For...»

«Targeting and Tailoring an Intervention for Adolescents with Overweight: Some Ethical Concerns Kirsti Riiser Institute of Nursing, Faculty of Health, Oslo and Akershus University College of Applied Sciences, Oslo, Norway; Department of Coaching and Psychology, Norwegian School of Sport Sciences, Oslo, Norway Knut Løndal Department of Primary and Secondary Teacher Education, Faculty of Education and International Studies, Oslo and Akershus University College of Applied Sciences, Oslo, Norway...»





 
<<  HOME   |    CONTACTS
2016 www.dissertation.xlibx.info - Dissertations, online materials

Materials of this site are available for review, all rights belong to their respective owners.
If you do not agree with the fact that your material is placed on this site, please, email us, we will within 1-2 business days delete him.