WWW.DISSERTATION.XLIBX.INFO
FREE ELECTRONIC LIBRARY - Dissertations, online materials
 
<< HOME
CONTACTS



«IS EPIZOOTIC RABBIT ENTEROPATHY (ERE) A BACTERIAL DISEASE? Huybens N.1*, Houeix J.1, Szalo M.1, Licois D.2, Mainil J.3, Marlier D.1 Department of ...»

Pathology and Hygiene

IS EPIZOOTIC RABBIT ENTEROPATHY (ERE) A BACTERIAL

DISEASE?

Huybens N.1*, Houeix J.1, Szalo M.1, Licois D.2, Mainil J.3, Marlier D.1

Department of Clinical Science, University of Liege, 20 boulevard de Colonster, 4000 Liège, Belgium

Animal Infectious Diseases and Veterinary Public Health Research Unit, Bat 213, INRA, 37380 Nouzilly, France

Department of infectious and parasitic diseases, University of Liege, 20 boulevard de Colonster, 4000 Liège, Belgium *Corresponding author: nathalie.huybens@ulg.ac.be ABSTRACT The etiology of epizootic rabbit enteropathy (ERE) is still unknown despite ten years of continuous research. A putative bacterial etiology is at the basis of current research. The fractionation of the reference inoculum (TEC4) is a major step to find the potential bacterial agent(s). In this study, TEC4 was fractionated with two techniques: centrifugation on discontinuous sucrose gradient then cell adhesion. Two selected fractions were inoculated to SPF rabbits and analyzed with classical bacteriological techniques. ERE was reproduced with both fractions. The 16S rDNA gene was amplified in all fractions and in three negative controls and subsequently analyzed with Restriction Fragment Length Polymorphism (RFLP) and Denaturating Gradient Gel Electrophoresis (DGGE). A difference in bacterial DNA composition was found between virulent and non-virulent fractions which reinforce the potential role of bacteria in the etiology of ERE.

Keywords: ERE, Fractionation, Bacteria, DGGE, RFLP.

INTRODUCTION

Epizootic rabbit enteropathy (ERE) is a digestive syndrome that has spread throughout Europe since 1997 (Duval, 1998; Marlier and Vindevogel, 1998). This pathology induces a decrease in food and water intake with a high mortality rate. Other clinical signs sometimes observed are: aqueous diarrhea, caecal impaction, rambling noise, etc. Typical lesions observed at necropsy are overfull anterior digestive tract, stomach included, without inflammation process (Licois et al., 2005). Bacitracine and tiamuline are the only known effective treatment. Unfortunately, mortality may start again by the end of the treatment (Maertens et al., 2005). ERE is the first cause of mortality in European rabbit industry and cost approximately ten millions of euros yearly in Belgium (Dewree et al., 2003).

Although it is commonly accepted that ERE is an infectious disease, the etiological agent is still unidentified today (Licois, 1998; Licois et al., 2000; Marlier et al., 2006; Szalo et al., 2007). An inoculum (TEC) made from digestive contents of ERE dead rabbits systematically reproduces the pathology(Licois and Coudert, 2003), first generation of TEC was TEC1 and last is TEC4. Szalo et al (2007) fractioned TEC3 with a centrifugation on discontinued gradient sucrose. The inoculation on SPF rabbit showed that 30% fraction and pellet reproduce the pathology whereas supernatant does not reproduce (Szalo et al., 2007). The aims of this study are fractionate TEC4 (Licois and Coudert, 2005) and analyzing its bacterial flora to prove that the etiological agent is one or several bacteria.

–  –  –

Inoculum and culture cells TEC4 was first fractionated by the technique described by Szalo et al. (2007). The 50% fraction of the centrifugation (50%) was then used for a second fractionation using rabbit kidney cells (RK13 cells).

9th World Rabbit Congress – June 10-13, 2008 – Verona – Italy Twenty-four hours before cell inoculation, the culture medium of a confluent box of 75 cm2 was changed for a medium without antibiotic. Twenty-four hours later, the culture medium was discarded and 1 ml of 50% fraction was added on the cells. After 4 h at 37°C, culture was rinsed three times with sterile PBS to wash out non adherent bacteria. Cells and adherent bacteria were then scraped with a cell scraper then suspended in 1 ml of antibiotic free medium. This inoculum was named RK501 and stored at -20°C.

Reproduction of the disease

Fifty-four 4-weeks old rabbits were randomly allocated to 3 batches with each batch split in 6 cages of 3 rabbits. After one week of acclimatization, batch one was inoculated per os with 100 µl/rabbit of 50%, batch two with 100 µl/rabbit of RK501 and batch three with 100 µl/rabbit of SPF rabbit’s caecal content (negative control). Each rabbit was weighted at D-7, D-4, D0, D3, D6, D8, D10 and D13.

Mortality and presence of diarrhea were written down each day.

Statistical analyses were performed with SAS (Statistical Analysis System, 2000). Linear model with Repeated Measures was used with as effects treatment, day and interaction between both.

Bacteriological analyses Ten µl of each fraction were inoculated onto agar plates and incubated for 24 h at 37°C, aerobically on 5% sheep blood agar and anaerobically (80% N2, 10% CO2 and 10% H2) on 5% sheep blood agar and Schaedler agar. Individual colonies were identified using standard procedure and commercial galleries (API Strep, Rapid ID 32A and Api 20 NE from BIOMERIEUX).

Bacterioscopic analyses The bacterioscopic analyses were performed as described in Szalo et al. (2007).

Restriction Fragment Length Polymorphism (RFLP) Total DNA was extracted from TEC3, TEC4, the seven sucrose fractions, RK501 and caecal contents of 3 healthy rabbits (TEM1, TEM2, TEM3) with QIAamp DNA Stool Mini Kit (Qiagen) following manufacturer instructions. The 16S rDNA genes were amplified by PCR with universal primers (5’AGAGTTTGATCMTGGCTCAG-3’ and 5’-TACGGYTACCTTGTTACGACTT-3’). Amplification conditions were 30 cycles with 30s at 94°C, 30 s at 61.5°C and 90 s at 72°C, with an initial denaturation and a final elongation of 5 min. PCR products were dialyzed on 0,025 µm membrane (Millipore) and DNA concentration was measured with spectrophotometry at 260 nm. Each sample was digested with 13 different restriction enzymes (Acc I, Alu I, Ava II, Cfo I, Cla I, EcoR I, Hpa I, Msp I, Pvu II, Rsa I, Sal I, Sau3AI and Taq I). One microgram of purified DNA was digested with 1 U of enzyme and 2 µl of enzyme buffer in 20 µl total volume during 1 h at enzyme specific temperature.





Profiles were analyzed with the Bio-Gene software (Vilber Lourmat®).

Denaturating Gradient Gel Electrophoresis (DGGE)

V3 region of 16S rDNA was amplified by a nested-PCR. The first PCR, with primers 5’AGAGTTTGATCM TGGCTCAG-3’ and 5’-TACGGYTACCTTGTTACGACT T-3’, amplified the whole gene. Amplification conditions were 17 cycles with 30 s at 94°C, 30 s at 61.5°C and 90 s at 72°C. The second PCR amplified V3 region with primers 5’CGCCCGCCGCGCGCGGCGGGCGGGGCG GGGGCACGGGGGGCCTACGGGAGGCAGCAG– 3’ and 5’-ATTACCGCGGCTGCTGG-3’. Amplification conditions were 35 cycles with 30 s at 94°C, 30 s at 55°C and 60 s at 72°C, with an initial denaturation and a final elongation of 5 min for the two PCR. DGGE was performed using DCode System (Bio-Rad Laboratories, USA) onto 8% polyacrylamide gel in 1x Tris-acetate-EDTA buffer (TAE), which contained a 35-55% denaturant gradient (100% denaturant, 7 M Urea and 40% (v/v) deionised formamide). Forty microlitres of PCR

Pathology and Hygiene

products were loaded on the gel and run 5 h, at constant temperature and voltage (60°C and 130V).

Gel was revealed with 2 µl GelStar® Nucleic Acid Gel Stain in 15 ml of distilled water. Interesting bands were excised and immersed into Tris-EDTA buffer 24 h at 4°C to extract DNA from gel then stored at -20°C.

–  –  –

Reproduction of the disease The mortality has begun four days after inoculation (D4). Two of eighteen rabbits inoculated with RK501 died at D4 and three more on D5. One of eighteen rabbits inoculated with 50% died at D4 and one more at D5. Global mortality rates were 28% and 11% respectively for batch inoculated with RK501 and 50%. These rates are similar to those observed in reference inoculation protocols (Licois et al., 2005). Autopsies revealed typical ERE’s lesions. The average daily weight gain curve (Figure 1) is marked by a severe drop as soon as the D3 for either batch inoculated with the 50% fraction (P=0.0014) or with RK501 (P=0.0091). Seventeen rabbits out of 18 in both batches have showed a drop in their daily weight gain for several continuous days. Global morbidity rate is thus 94% for the two batches.

Figure 1: Comparison and evolution of average daily weight gain (ADWG) between the negative control batch and the two inoculated batches with 50% fraction and RK501 fraction These results confirmed that the etiological agent is present in quality and quantity in both fractions.

Since viral particles stay in the supernatant fraction and are not present in the 50% fraction, that reproduced the pathology, no virus can be considered as the etiological agent of ERE.

Bacteriological and bacterioscopic analyses Bacterioscopic counts are presented in Figure 2. A selection is made through the fractionation. Gram negative bacteria seem absent of the RK501 fraction.

Figure 2: Bacteria’s repartition following stain and shape during the fractionation 9th World Rabbit Congress – June 10-13, 2008 – Verona – Italy Of the 13 species detected in the 50% fraction, only 4 were also isolated from RK501 fraction and two other species were present in RK501 fraction but not in the 50% fraction (Table 1). Most species had already been identified previously, except Brevundimonas vesicularis, Sphingobacterium spiritivorum, Gemella morbillorum and Mannheimia haemolytica. The first three species are opportunist pathogens, but the last one is a primary respiratory pathogen of ruminants. These results show an evolution of the bacterial flora during the fractionation with selection for some species including the etiological agent like the inoculation on rabbit shows.

–  –  –

RFLP The restriction profiles showed no specific pattern to the fractions that reproduce ERE.

DGGE The gel is showed on Figure 3. A band of high intensity is present in all fractions reproducing ERE, while it is of low intensity in the two negative controls and absent from supernatant that do not reproduce ERE. This band will be cloned and sequenced, and will hopefully help in identifying the etiological agent of ERE.

Figure 3: Section of DGGE profile of the different fractions. TEM1, TEM2, TEM3: caecal contents of healthy rabbits; SU, 10, 20, 30, 40, 50, CT: seven sucrose fractions; RK501: cell fraction; TEC3, TEC4: reference inoculums

–  –  –

ERE’s etiology is still unknown but bacterial hypothesis is strongly reinforced. Effectively, our study excludes the viral agents as primary pathogens in the development of ERE. The fractionation of TEC4 is necessary to identify etiological agent. The two fractionations used, centrifugation on discontinuous sucrose gradient and cell adhesion, seem to diminish the flora’s variety without loss of virulence. A difference in bacterial DNA composition of the fractions was found with DGGE and RFLP profiles but only the DGGE showed difference between virulent and non-virulent fractions. This can reinforce the theory of bacterial etiology but further investigations are needed to obtain DNA sequence information and to explain this difference.

–  –  –

This work was supported by a Grant from the ''Service Publique Fédéral Santé Publique, sécurité de la chaîne alimentaire et environnement: Division Recherche contractuelle", contract RT 06/7 MINRABBIT. N. Huybens is a PhD fellow of the “Fonds pour la formation à la Recherche dans l’Industrie et dans l’Agriculture” (FRIA).

REFERENCES

Dewree R., Licois D., Coudert P., Lassence C., Vindevogel H., Marlier D. 2003. L'entéropathie épizootique du lapin (EEL):

étude du rôle des infections par Clostridium perfringens dans l'étio-pathogénie de ce syndrome. In: Proc. 10èmes Journées de la Recherche Cunicole, 2003 November, Paris, France, 251-254.

Duval M.L. 1998. Développement de l'entérocolite en France. In: Proc. 7èmes Journées de la Recherche Cunicole, Séance d'actualité: L'entérocolite épizootique, 1998 May, Lyon, France, 1-8.

Licois D. 1998. Bilan des travaux réalisés à l'INRA sur l'entérocolite épizootique, dans l'hypothèse d'une étiologie virale de la maladie. In: Proc. 7èmes Journées de la Recherche Cunicole, Séance d'actualité: L'entérocolite épizootique, 1998 May, Lyon, France, 20-25.

Licois D., Coudert P. 2003. Entéropathie Epizootique du Lapin: reproduction expérimentale, symptômes et lésions observées.

In: Proc. 10èmes Journées de la Recherche Cunicole, 2003 November, Paris, France, 139-144.

Licois D., Coudert P. 2005. Entéropathie épizootique du lapin. Pouvoir infectieux de l'inoculum TEC4: effet dose et maintien de la virulence en fonction du temps. In: Proc. 11èmes Journées de la Recherche Cunicole, 2005 November, Paris, France, 265-268.

Licois D., Coudert P., Ceré N., Vautherot J.F. 2000. Epizootic enterocolitis of the rabbit: review of current research. In: Proc.

Proc. 7th World Rabbit Congress, 2000 July, Valencia, Spain, 187-194.

Licois D., Wyers M., Coudert P. 2005. Epizootic rabbit enteropathy: experimental transmission and clinical characterization.

Veterinary Research, 36, 601-613.

Maertens L., Cornez B., Vereecken M., Oye S.V. 2005. Efficacy study of soluble bacitracin (Bacivet S(R)) in a chronically infected Epizootic Rabbit Enteropathy environment. World Rabbit Sci., 13, 165-178.

Marlier D., Dewree R., Lassence C., Licois D., Mainil J., Coudert P., Meulemans L., Ducatelle R., Vindevogel H. 2006.

Infectious agents associated with epizootic rabbit enteropathy: Isolation and attempts to reproduce the syndrome. Vet. J., 172, 493-500.

Marlier D., Vindevogel H. 1998. L'entérocolite épizootique du lapin. Ann. Méd. Vét., 142, 281-284.

Szalo I.M., Lassence C., Licois D., Coudert P., Poulipoulis A., Vindevogel H., Marlier D. 2007. Fractionation of the reference inoculum of epizootic rabbit enteropathy in discontinuous sucrose gradient identifies aetiological agents in high density fractions. Vet. J., 173, 652-657.



Similar works:

«G protein-coupled estrogen receptor (GPER) regulates mammary tumorigenesis and metastasis Nicole A. Marjon, Chelin Hu, Helen J. Hathaway* and Eric R. Prossnitz*# Department of Cell Biology & Physiology, and UNM Cancer Center, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 * Equal Contribution Running Title: GPER regulation of mammary carcinogenesis Keywords: Estrogen, Receptors, Breast, Tumorigenesis, Metastasis Financial Support: This study was supported by NIH grants...»

«Safeguard your family's future against life's uncertainties Birla Sun Life Insurance Easy Protect Plan A traditional term insurance plan INTRODUCING BSLI Easy Protect Plan You are successful in your career and your family looks upon you for your support and strength. You have till now given the best to your family. However when it comes to planning for unforeseen circumstances, you need a powerful solution that meets different expectations and gives financial protection to your family. To deal...»

«Ethiopia Health Sector – Federal Ministry of Health Case Study The Situation Ethiopia has long struggled with major health problems, most of which are largely preventable communicable diseases and malnutrition. Ethiopia began proactively attacking the problem when the 1991 transitional Government produced a health policy that was the first of its kind in the country. This policy was one of several political and socio-economic transformation policies and the translation of this new health...»

«EUROPEAN COMMISSION HEALTH & CONSUMERS DIRECTORATE-GENERAL SANCO G – D(2011) 1078275 SUMMARY RECORD OF THE STANDING COMMITTEE ON THE FOOD CHAIN AND ANIMAL HEALTH HELD IN BRUSSELS ON 7 & 8 SEPTEMBER 2011 (Section Animal Health and Welfare) Presidents: Bernard Van Goethem, Alberto Laddomada. All Member States were present. 1. Information from Lithuania on the classical swine fever outbreaks in domestic pigs. The Lithuanian representative presented a comprehensive chronology of all events that...»

«(Music) Mark Masselli: This is Conversations on Healthcare, I am Mark Masselli. Margaret Flinter: And I am Margaret Flinter. Mark Masselli: Well Margaret, another key Obama administrator stepping down, Peggy Hamburg, FDA Commissioner for the past 6 years and now she is leaving her post at the end of March saying she does have mixed emotions. Margaret Flinter: Well she certainly wrapped up a number of achievements during her 10-year mark. She worked to modernize food safety over set stricter...»

«NATIONAL ACADEMY OF SCIENCES HENRY G. KUNKEL 1916– 1983 A Biographical Memoir by JACOB B. NATVIG AND J. DONALD CAPRA Any opinions expressed in this memoir are those of the author and do not necessarily reflect the views of the National Academy of Sciences. Biographical Memoirs, COPYRIGHT 2006 NATIONAL ACADEMY OF SCIENCES WASHINGTON, D.C. Photograph courtesy The Rockefeller University Archives. HENRY G. KUNKEL September 9, 1916–December 15, 1983 BY JACOB B. NATVIG AND J. DONALD CAPRA H a...»

«Annual Report and Accounts 2015 / 16 2 Wirral University Teaching Hospital NHS Foundation Trust Annual Report and Accounts 2015/16 Presented to Parliament pursuant to Schedule 7, paragraph 25 (4) (a) of the National Health Service Act 2006. 3 © 2016 Wirral University Teaching Hospital NHS Foundation Trust 4 Contents Page 6 Performance Report 6 • Message from the Chairman and Chief Executive 9 • Overview of Performance 20 • Performance Analysis Accountability Report 32 • Director’s...»

«Final List of Potential EIS Assignments EIS Class of 2016 April 2016 Last updated April 28, 2016 Table of Contents EIS Assignments PAGE Division of Scientific Education and Professional development / EIS Workforce Branch • Arizona: Arizona Department of Health Services and Maricopa County Department of Public Health • California: California Health and Human Services/Division of Environmental and Occupational Disease Control • California: California Health and Human Services/Division...»

«Interim Evaluation of the Sore Throat Management Component of the New Zealand Rheumatic Fever Prevention Programme Quantitative Findings Final Technical Report of Quantitative Findings October 2015 Whāia te iti kahurangi, ki te tuohu koe me maunga teitei Pursue that which is precious, and do not be deterred by anything less than a lofty mountain PREPARED FOR: Ministry of Health CLIENT REPORT No: FW15039 Quantitative Findings: Interim Evaluation of Sore Throat Component of the NZ RFPP October...»

«ERASMUS MUNDUS SCHOLARSHIP PROGRAMME Knowledge, Attitudes and Practices addressing young child diarrhoea in Moramanga, Madagascar: The MOSAIQUE cross cultural qualitative study Karine RENAUDIE Centre for International Health Faculty of Medicine and Dentistry University of Bergen, Norway 2011 0 Knowledge, Attitudes and Practices addressing young child diarrhoea in Moramanga, Madagascar: The MOSAIQUE cross cultural qualitative study Karine RENAUDIE Master’s thesis submitted to the Centre for...»

«Silicate injection for IOR. Master thesis conducted by Kevin Jarleiv Hardy For the University of Stavanger, Petroleum Reservoir Abstract This thesis is a literature study of sodium silicate as an enhanced oil recovery method. We will follow the steps from experiments conducted, simulations, and then actual field operations conducted in the Snorre field, Norway. The objective of the sodium silicate is to plug high permeable zones in the reservoir (in – depth); in order to divert the following...»

«Voluntas (2012) 23:236–256 DOI 10.1007/s11266-011-9195-3 ORIGINAL PAPER From ‘‘dot.org’’ to ‘‘dot.gov’’: Professional Crossings in the Brazilian National Policy on HIV/AIDS Luiz Claudio Marques Campos • Patricia Maria Mendonca • Mario Aquino Alves ¸ Published online: 24 May 2011 Ó International Society for Third-Sector Research and The John’s Hopkins University 2011 Abstract This article reflects on the importance of the relations between state and society in...»





 
<<  HOME   |    CONTACTS
2016 www.dissertation.xlibx.info - Dissertations, online materials

Materials of this site are available for review, all rights belong to their respective owners.
If you do not agree with the fact that your material is placed on this site, please, email us, we will within 1-2 business days delete him.